Skip to Main Content
More Intelligent Procurement, Faster R&D

Go to Main Navigation

82122

Scientist.com Supplier

NLRP3 Human shRNA Lentivirus

BPS Bioscience

DESCRIPTION

The NLRP3 shRNA Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain 3 shRNAs (Short hairpin RNA) targeting human NLRP3 driven by a U6 promoter, and a puromycin selection marker (Figures 1). The sequences of the shRNA used are shown. List of shRNA sequences present in the NLRP3 shRNA Lentivirus. Gene Target NLRP3 GAGACTCAGGAGTCGCAATTT NLRP3 GGCTGTAACATTCGGAGATTG NLRP3 TCATCATTCCCGCTATCTTTC

DETAILS

  • Notes: To generate a NLRP3 knockdown stable cell line, remove the growth medium 48 hours after transduction and replace it with fresh growth medium containing the appropriate amount of puromycin (as pre-determined from a killing curve, https://bpsbioscience.com/cell-line-faq), for antibiotic selection of transduced cells, following by clonal selection. BiosafetyThe lentiviruses are produced with a SIN (self-inactivation) lentivector which ensures self-inactivation of the lentiviral construct after transduction and after integration into the genomic DNA of the target cells. None of the HIV genes (gag, pol, rev) will be expressed in the transduced cells, as they are expressed from packaging plasmids lacking the packing signal and are not present in the lentivirus particle. Although the pseudotyped lentiviruses are replication-incompetent, they require the use of a Biosafety Level 2 facility. BPS Bioscience recommends following all local federal, state, and institutional regulations and using all appropriate safety precautions. Troubleshooting Guide: Visit bpsbioscience.com/lentivirus-faq for detailed troubleshooting instructions. For all further questions, please email support@bpsbioscience.com
  • Shiptemp: -80°C (dry ice)
  • Warnings: Avoid freeze/thaw cycles
  • Category: Cell Signaling/Cell Line
  • Background: NOD, LRR and pyrin domain containing 3 (NLRP3), also known as NALP3 and cryopyrin, is a pattern recognition receptor (PRR) of the NRL (NOD-like receptor) subfamily. It is involved in the detection of microbes, endogenous and exogenous stress signals. It is expressed in macrophages and when bound to PYCARD (adaptor ASC protein) forms a caspase-1 activating complex named NRLP3 inflammasome. NLRP3 detects uric acid and extracellular ATP in damaged cells, and once activated it leads to an immune response. Upon activation, NLRP3 inflammasome releases its partners HSP90 and SGT1, and binds to PYCARD and caspase-1. Caspase-1 initiates the processing and release of the pro-inflammatory cytokines IL-1β and IL-18 and gasdermin D-mediated pyroptotic cell death. Mutations in NLRP3 are known to cause autoinflammatory and neuroinflammatory diseases, such as Alzheimer's, Parkinson's, and prion disease. NLRP3 is the most extensively studied inflammasome protein to date due to its array of activators and aberrant activation in several inflammatory diseases. Studies into its function and inhibition can lead to the development of therapeutic avenues for the treatment of auto-inflammatory diseases.
  • References: Swanson K et al., 2019 Nature Reviews Immunology 19:477-489.
  • Description: The NLRP3 shRNA Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain 3 shRNAs (Short hairpin RNA) targeting human NLRP3 driven by a U6 promoter, and a puromycin selection marker (Figures 1). The sequences of the shRNA used are shown. List of shRNA sequences present in the NLRP3 shRNA Lentivirus. Gene Target NLRP3 GAGACTCAGGAGTCGCAATTT NLRP3 GGCTGTAACATTCGGAGATTG NLRP3 TCATCATTCCCGCTATCTTTC
  • Formulation: The lentivirus particles were produced from HEK293T cells in medium containing 90% DMEM + 10% FBS. Virus particles can be packaged in custom formulations by special request, for an additional fee.
  • Supplied As: Two vials (500 µl x 2) of lentivirus at a titer ≥5 x 106 TU/ml. The titer varies with each lot; the exact value is provided with each shipment.
  • Unspsc Code: 41106621
  • Unspsc Name: Virus mediated expression vectors or kits
  • Applications: Generate a NLRP3 knockdown cell pool following puromycin Generate a NLRP3 knockdown cell line following puromycin selection and limiting dilution.
  • Product Type: Lentivirus
  • Biosafety Level: BSL-2
  • Related Products: 40741, 78545, 78546
  • Storage Stability: Lentiviruses are shipped with dry ice. For long term storage, it is recommended to store the lentiviruses at -80°C.
  • Scientific Category: Cell Signaling Pathway