Skip to Main Content
Welcome to theĀ Scientist.comĀ Marketplace

Go to Main Navigation

CSB-CL020340HU

RPLP1

Cusabio

DETAILS

  • Length: 345
  • Vector: pENTR223.1
  • Gene Id: 6176
  • Sequence: ATGGCCTCTGTCTCCGAGCTCGCCTGCATCTACTCGGCCCTCATTCTGCACGACGATGAGGTGACAGTCACGGAGGATAAGATCAATGCCCTCATTAAAGCAGCCGGTGTAAATGTTGAGCCTTTTTGGCCTGGCTTGTTTGCAAAGGCCCTGGCCAACGTCAACATTGGGAGCCTCATCTGCAATGTAGGGGCCGGTGGACCTGCTCCAGCAGCTGGTGCTGCACCAGCAGGAGGTCCTGCCCCCTCCACTGCTGCTGCTCCAGCTGAGGAGAAGAAAGTGGAAGCAAAGAAAGAAGAATCCGAGGAGTCTGATGATGACATGGGCTTTGGTCTTTTTGACTAA
  • Lead Time: 3-5 business days
  • Accession No: BC003369