Skip to Main Content
Welcome to theĀ Scientist.comĀ Marketplace

Go to Main Navigation

CSB-CL020336HU1

RPLP0

Cusabio

DETAILS

  • Length: 954
  • Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Gene Id: 6175
  • Sequence: ATGCCCAGGGAAGACAGGGCGACCTGGAAGTCCAACTACTTCCTTAAGATCATCCAACTATTGGATGATTATCCGAAATGTTTCATTGTGGGAGCAGACAATGTGGGCTCCAAGCAGATGCAGCAGATCCGCATGTCCCTTCGTGGGAAGGCTGTGGTGCTGATGGGCAAGAACACCATGATGCGCAAGGCCATCCGAGGGCACCTGGAAAACAACCCAGCTCTGGAGAAACTGCTGCCTCATATCCGGGGGAATGTGGGCTTTGTGTTCACCAAGGAGGACCTCACTGAGATCAGGGACATGTTGCTGGCCAATAAGGTGCCAGCTGCTGCCCGTGCTGGTGCCATTGCCCCATGTGAAGTCACTGTGCCAGCCCAGAACACTGGTCTCGGGCCCGAGAAGACCTCCTTTTTCCAGGCTTTAGGTATCACCACTAAAATCTCCAGGGGCACCATTGAAATCCTGAGTGATGTGCAGCTGATCAAGACTGGAGACAAAGTGGGAGCCAGCGAAGCCACGCTGCTGAACATGCTCAACATCTCCCCCTTCTCCTTTGGGCTGGTCATCCAGCAGGTGTTCGACAATGGCAGCATCTACAACCCTGAAGTGCTTGATATCACAGAGGAAACTCTGCATTCTCGCTTCCTGGAGGGTGTCCGCAATGTTGCCAGTGTCTGTCTGCAGATTGGCTACCCAACTGTTGCATCAGTACCCCATTCTATCATCAACGGGTACAAACGAGTCCTGGCCTTGTCTGTGGAGACGGATTACACCTTCCCACTTGCTGAAAAGGTCAAGGCCTTCTTGGCTGATCCATCTGCCTTTGTGGCTGCTGCCCCTGTGGCTGCTGCCACCACAGCTGCTCCTGCTGCTGCTGCAGCCCCAGCTAAGGTTGAAGCCAAGGAAGAGTCGGAGGAGTCGGACGAGGATATGGGATTTGGTCTCTTTGACTAA
  • Lead Time: Inquiry
  • Accession No: BC000345