Skip to Main Content
Welcome to theĀ Scientist.comĀ Marketplace

Go to Main Navigation

CSB-CL020365HU

RPS11

Cusabio

DETAILS

  • Length: 477
  • Vector: pENTR223.1
  • Gene Id: 6205
  • Sequence: ATGGCGGACATTCAGACTGAGCGTGCCTACCAAAAGCAGCCGACCATCTTTCAAAACAAGAAGAGGGTCCTGCTGGGAGAAACTGGCAAGGAGAAGCTCCCGCGGTACTACAAGAACATCGGTCTGGGCTTCAAGACACCCAAGGAGGCTATTGAGGGCACCTACATTGACAAGAAATGCCCCTTCACTGGTAATGTGTCCATTCGAGGGCGGATCCTCTCTGGCGTGGTGACCAAGATGAAGATGCAGAGGACCATTGTCATCCGCCGAGACTATCTGCACTACATCCGCAAGTACAACCGCTTCGAGAAGCGCCACAAGAACATGTCTGTACACCTGTCCCCCTGCTTCAGGGACGTCCAGATCGGTGACATCGTCACAGTGGGCGAGTGCCGGCCTCTGAGCAAGACAGTGCGCTTCAACGTGCTCAAGGTCACCAAGGCTGCCGGCACCAAGAAGCAGTTCCAGAAGTTCTGA
  • Lead Time: 3-5 business days
  • Accession No: BC007283